Stem-loop sequence aca-mir-125b-1

AccessionMI0018725 (change log)
DescriptionAnolis carolinensis miR-125b-1 stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention aca-mir-125b-1
(1 sentences)

Stem-loop
   --u    cc   u u uc  ug   c           -  guuua 
5'    gcgc  cuc c g  cc  aga ccuaacuugug ac     g
      ||||  ||| | |  ||  ||| ||||||||||| ||     u
3'    cgug  gag g c  gg  ucu ggauugggcac ug     u
   cac    uu   u u ga  gu   c           c  aauuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
CM000943.1: 2579058-2579147 [-]
intergenic
Database links

Mature sequence aca-miR-125b

Accession MIMAT0021729
Sequence

15 - 

ucccugagacccuaacuuguga

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).