Stem-loop sequence aca-mir-124b

AccessionMI0018723 (change log)
DescriptionAnolis carolinensis miR-124b stem-loop
Gene family MIPF0000021; mir-124
Literature search

1 open access papers mention aca-mir-124b
(1 sentences)

Stem-loop
   cu   aaagg  --    --   gc        a   ga        uaaau 
5'   ggc     cc  ccuc  ucu  guguucac gcg  ccuugauu     g
     |||     ||  ||||  |||  |||||||| |||  ||||||||     u
3'   ucg     gg  ggag  aga  cguaagug cgc  ggaauuaa     c
   -u   -agaa  uc    ca   au        g   ac        cauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 40554176-40554276 [-]
intergenic
Database links

Mature sequence aca-miR-124b

Accession MIMAT0021726
Sequence

60 - 

uaaggcacgcggugaaugcua

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).