Stem-loop sequence aca-mir-124a-3

AccessionMI0018722 (change log)
DescriptionAnolis carolinensis miR-124a-3 stem-loop
Gene family MIPF0000021; mir-124
Literature search

1 open access papers mention aca-mir-124a-3
(2 sentences)

Stem-loop
   --ccccc     -  u   c   c        a   ga       uuca   g 
5'        caggg cu ggc cuu guguucac gug  ccuugau    ugu g
          ||||| || ||| ||| |||||||| |||  |||||||    |||  
3'        guccc ga ccg gaa cguaagug cgc  ggaauua    aca a
   gccuccc     c  c   a   c        g   ac       ----   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL344007.1: 104523-104623 [-]
intergenic
Database links

Mature sequence aca-miR-124a

Accession MIMAT0021725
Sequence

59 - 

uaaggcacgcggugaaugcca

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).