Stem-loop sequence aca-mir-124a-2

AccessionMI0018721 (change log)
DescriptionAnolis carolinensis miR-124a-2 stem-loop
Gene family MIPF0000021; mir-124
Literature search

1 open access papers mention aca-mir-124a-2
(2 sentences)

Stem-loop
   ---cccuccc     c      - c        a   ga        uaaug 
5'           gggcc uucucu g guguucac gcg  ccuugauu     u
             ||||| |||||| | |||||||| |||  ||||||||      
3'           cucgg gagaga c cguaagug cgc  ggaauuaa     c
   cuacagaacu     c      a -        g   ac        cauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 153195184-153195284 [+]
intergenic
Database links

Mature sequence aca-miR-124a

Accession MIMAT0021725
Sequence

59 - 

uaaggcacgcggugaaugcca

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).