Stem-loop sequence aca-mir-103

AccessionMI0018715 (change log)
DescriptionAnolis carolinensis miR-103 stem-loop
Gene family MIPF0000024; mir-103
Stem-loop
   -----uauuu    c        --   u  u           c   u g u 
5'           cucg ugccuuca  gcu cu uacagugcugc uug u c u
             |||| ||||||||  ||| || ||||||||||| ||| | |  
3'           gagu acggaagu  cgg ga auguuacgacg aac a g a
   acuucgucau    u        au   -  c           -   u g u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 189292145-189292241 [+]
sense
ENSACAT00000019711 ; aca-mir-103-201; exon 1
ENSACAT00000011593 ; PANK3-201; intron 5
Database links

Mature sequence aca-miR-103-5p

Accession MIMAT0021715
Previous IDsaca-miR-103*
Sequence

18 - 

agcuucuuuacagugcugccu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-103-3p

Accession MIMAT0021716
Previous IDsaca-miR-103
Sequence

55 - 

agcagcauuguacagggcuaug

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).