Stem-loop sequence aca-mir-101-2

AccessionMI0018713 (change log)
DescriptionAnolis carolinensis miR-101-2 stem-loop
Gene family MIPF0000046; mir-101
Stem-loop
   --------------      c                    cg     guaua 
5'               acuguc uuuuucgguuaucaugguac  gugcu     u
                 |||||| ||||||||||||||||||||  |||||      
3'               ugguag aagaagucaauagugucaug  caugg     c
   gaguaacacuaccg      u                    -a     aaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 52137646-52137738 [+]
sense
ENSACAT00000018501 ; aca-mir-101-2-201; exon 1
ENSACAT00000003643 ; RCL1-201; intron 8
Database links

Mature sequence aca-miR-101-2-5p

Accession MIMAT0021712
Previous IDsaca-miR-101-2*
Sequence

12 - 

ucgguuaucaugguaccggug

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-101-3p

Accession MIMAT0021711
Previous IDsaca-miR-101
Sequence

49 - 

uacaguacugugauaacuga

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).