Stem-loop sequence aca-mir-100

AccessionMI0018711 (change log)
DescriptionAnolis carolinensis miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   -cuuccu    -  u c    a   cg    uc   a      cuuc 
5'        gcua gu g caca acc  uaga  cga cuugug    u
          |||| || | |||| |||  ||||  ||| ||||||    a
3'        cggu cg c gugu ugg  aucu  guu gaacac    u
   acuuaac    u  u u    a   au    gu   c      auug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
CM000943.1: 2624853-2624947 [-]
intergenic
Clustered miRNAs
< 10kb from aca-mir-100
aca-mir-100CM000943.1: 2624853-2624947 [-]
aca-let-7c-3CM000943.1: 2619225-2619315 [-]
Database links

Mature sequence aca-miR-100

Accession MIMAT0021709
Sequence

20 - 

aacccguagauccgaacuugug

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).