Stem-loop sequence aca-let-7e

Accession MI0018706
Description Anolis carolinensis let-7e stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a       -   g   cu   gu         a      -  ------    cc 
 ugcuguc cuu agg  gag  aguagauug auaguu gu      ggag  u
 ||||||| ||| |||  |||  ||||||||| |||||| ||      ||||  u
 augacag gga ucc  uuc  ucaucuaac uaucaa cg      ccuc  a
a       a   a   -u   ug         a      u  agucuc    uu 
Get sequence
Genome context
Coordinates (AnoCar2.0) Overlapping transcripts
4: 123683599-123683700 [-]
intergenic

Mature sequence aca-let-7e-5p

Accession MIMAT0021701
Previous IDs aca-let-7e
Sequence

17 - 

ugagguaguagauugaauaguu

 - 38

Get sequence
Evidence experimental; Solexa [1]

Mature sequence aca-let-7e-3p

Accession MIMAT0021702
Previous IDs aca-let-7e*
Sequence

64 - 

uaacuauacaaucuacugucuuuc

 - 87

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).