Stem-loop sequence sbi-MIR5389

AccessionMI0018696 (change log)
DescriptionSorghum bicolor miR5389 stem-loop
Literature search

1 open access papers mention sbi-MIR5389
(2 sentences)

Stem-loop
   ugcagccacaaacauaugcugcaaguacuaaugcuu          a   u  c     a u     cacua 
5'                                     uguucgcuug guu au agccg g cugaa     c
                                       |||||||||| ||| || ||||| | |||||      
3'                                     acaagugaac cga ua ucggu c gacuu     u
   -----------------------------------g          -   c  u     a c     uaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr8: 4826959-4827068 [+]
intergenic
Database links

Mature sequence sbi-miR5389

Accession MIMAT0021687
Sequence

42 - 

gcuugaguuuaucagccgagu

 - 62

Get sequence
Evidence experimental; SOLiD [1]

References

1