Stem-loop sequence sbi-MIR5388

AccessionMI0018695 (change log)
DescriptionSorghum bicolor miR5388 stem-loop
Literature search

1 open access papers mention sbi-MIR5388
(4 sentences)

Stem-loop
   aaaaaaaaau            -g  cc    caa              aaa     aa 
5'           cuuugccgggag  gu  ucag   acauucggcaaaga   uuuga  a
             ||||||||||||  ||  ||||   ||||||||||||||   |||||  a
3'           gaaacggccuuc  ca  aguc   ugugggccguuucu   agauu  a
   --------ac            ga  -c    -uc              aaa     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr8: 1576943-1577052 [+]
intergenic
Database links

Mature sequence sbi-miR5388

Accession MIMAT0021686
Sequence

71 - 

aucuuugccgggugucucugac

 - 92

Get sequence
Evidence experimental; SOLiD [1]

References

1