Stem-loop sequence sbi-MIR5387a

AccessionMI0018694 (change log)
Previous IDssbi-MIR5387
DescriptionSorghum bicolor miR5387 stem-loop
Gene family MIPF0001305; MIR5387
Literature search

1 open access papers mention sbi-MIR5387a
(1 sentences)

Stem-loop
   -----------------uc                       -a        ----       ac 
5'                    guaacacgaaccggugcuaaagg  ucuugccc    aacggcu  u
                      |||||||||||||||||||||||  ||||||||    |||||||   
3'                    cauugugcuuggccacgauuucc  gggacggg    uugucga  g
   uugggaaaugguggccaaa                       ca        guug       ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr7: 17116510-17116619 [+]
intergenic
Database links

Mature sequence sbi-miR5387a

Accession MIMAT0021685
Previous IDssbi-miR5387
Sequence

4 - 

uaacacgaaccggugcuaaaggauc

 - 28

Get sequence
Evidence experimental; SOLiD [1]

References

1