Stem-loop sequence sbi-MIR5386

AccessionMI0018693 (change log)
DescriptionSorghum bicolor miR5386 stem-loop
Literature search

1 open access papers mention sbi-MIR5386
(4 sentences)

Stem-loop
   ---------------c   --c  u   ua     - g     g gc  g   -   ---        
5'                 gca   ug ggg  ugcgu c cuguc c  gc cug cag   gccaugu 
                   |||   || |||  ||||| | ||||| |  || ||| |||   |||||| u
3'                 cgu   gc ccc  acgca g gacgg g  ug gac guc   cgguacc 
   accucuguacggguuu   ucu  u   -c     c a     - ac  -   u   cuu        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr7: 854632-854741 [+]
intergenic
Database links

Mature sequence sbi-miR5386

Accession MIMAT0021684
Sequence

16 - 

cgucgcugucgcgcgcgcug

 - 35

Get sequence
Evidence experimental; SOLiD [1]

References

1