Stem-loop sequence sbi-MIR5385

AccessionMI0018692 (change log)
DescriptionSorghum bicolor miR5385 stem-loop
Literature search

2 open access papers mention sbi-MIR5385
(6 sentences)

Stem-loop
   -- g  u     -       c                c            c  g c 
5'   g ag uuugc acgccgc gcuucucaccaccaac ccaccgcuucuc gc c g
     | || ||||| ||||||| |||||||||||||||| |||||||||||| || |  
3'   c uu agacg ugcggcg cgaagaguggugguug gguggcgaagag cg g a
   ga g  u     g       a                u            -  g g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 55351481-55351590 [+]
intergenic
Database links

Mature sequence sbi-miR5385

Accession MIMAT0021683
Sequence

26 - 

accaccaaccccaccgcuucuc

 - 47

Get sequence
Evidence experimental; SOLiD [1]

References

1