Stem-loop sequence sbi-MIR5381

AccessionMI0018688 (change log)
DescriptionSorghum bicolor miR5381 stem-loop
Literature search

1 open access papers mention sbi-MIR5381
(1 sentences)

Stem-loop
   ----------------------------gcuuuaaaccaaa           -      c    u   a 
5'                                          gcucggcgcua agaucu uggc ccg c
                                            ||||||||||| |||||| |||| |||  
3'                                          cgagccgcggu ucuaga accg ggc c
   cuagacccgcgacugguuccgcgguacaccggaccgcagcu           g      -    c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 562993-563102 [+]
intergenic
Database links

Mature sequence sbi-miR5381

Accession MIMAT0021679
Sequence

51 - 

aagaucuguggcgccgagc

 - 69

Get sequence
Evidence experimental; SOLiD [1]

References

1