Stem-loop sequence gma-MIR171l

AccessionMI0018687 (change log)
DescriptionGlycine max miR171l stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

15 open access papers mention gma-MIR171l
(36 sentences)

Stem-loop
     g    c          a         c  a  -  -ga     a   a 
5' ga aaag gauguuggug gguucaauc ga ga cg   uuuac ugu g
   || |||| |||||||||| ||||||||| || || ||   ||||| |||  
3' cu uuuc cuauaaccgc ccgaguuag cu cu gc   aaaug acg a
     a    a          g         a  -  a  aua     -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 8830894-8830991 [-]
intergenic
Database links

Mature sequence gma-miR171l

Accession MIMAT0021678
Sequence

8 - 

cgauguuggugagguucaauc

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).