|
miRBase |
|
Stem-loop sequence gma-MIR171l |
|||||
| Accession | MI0018687 | ||||
| Description | Glycine max miR171l stem-loop | ||||
| Gene family | MIPF0000030; MIR171_1 | ||||
| Stem-loop |
g c a c a - -ga a a ga aaag gauguuggug gguucaauc ga ga cg uuuac ugu g || |||| |||||||||| ||||||||| || || || ||||| ||| cu uuuc cuauaaccgc ccgaguuag cu cu gc aaaug acg a a a g a - a aua - a |
||||
| Genome context |
|
||||
Mature sequence gma-miR171l |
|
| Accession | MIMAT0021678 |
| Sequence |
8 - cgauguuggugagguucaauc - 28 |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|