Stem-loop sequence gma-MIR167j

AccessionMI0018686 (change log)
DescriptionGlycine max miR167j stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

26 open access papers mention gma-MIR167j
(187 sentences)

Stem-loop
         u      u    g         ag      uu 
5' cagcag ugaagc gcca caugaucug  uuuacc  c
   |||||| |||||| |||| |||||||||  ||||||  u
3' guuguc acuucg cggu guacuagac  gaaugg  a
         c      u    -         aa      uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 45890458-45890535 [+]
intergenic
Database links

Mature sequence gma-miR167j

Accession MIMAT0021677
Sequence

8 - 

ugaagcugccagcaugaucug

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).