Stem-loop sequence gma-MIR482d

AccessionMI0018681 (change log)
DescriptionGlycine max miR482d stem-loop
Gene family MIPF0000403; MIR482
Literature search

21 open access papers mention gma-MIR482d
(44 sentences)

Stem-loop
              ug           -auu           uc    ag 
5' gggggaagaca  gguaugggggg    gggaaggaaua  caua  c
   |||||||||||  |||||||||||    |||||||||||  ||||  a
3' cuccuuuuugu  ccauacccucc    cccuucuuuau  guau  a
              ca           acau           -u    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 49165318-49165412 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR482d
gma-MIR2118bchr10: 49169712-49169821 [-]
gma-MIR482dchr10: 49165318-49165412 [-]
Database links

Mature sequence gma-miR482d-5p

Accession MIMAT0021671
Sequence

16 - 

uauggggggauugggaaggaau

 - 37

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence gma-miR482d-3p

Accession MIMAT0021672
Sequence

61 - 

ucuucccuacaccucccauacc

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).