Stem-loop sequence gma-MIR396i

AccessionMI0018680 (change log)
DescriptionGlycine max miR396i stem-loop
Gene family MIPF0000047; MIR396
Literature search

25 open access papers mention gma-MIR396i
(145 sentences)

Stem-loop
   u      c       uc            c          -uc  ------------u     u    u   u 
5'  ggcccu uuuguau  uuccacagcuuu uugaacugca   ca             agagu ccuu gca g
    |||||| |||||||  |||||||||||| ||||||||||   ||             ||||| |||| |||  
3'  cuggga agacaua  agggugucgaaa aacuuggcgu   gu             ucuca ggaa cgu c
   a      u       ga            u          uuu  uccacacccucgu     c    c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 8774041-8774175 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR396i
gma-MIR396ichr17: 8774041-8774175 [+]
gma-MIR396dchr17: 8782240-8782347 [-]
Database links

Mature sequence gma-miR396i-5p

Accession MIMAT0021669
Sequence

18 - 

uuccacagcuuucuugaacug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR396i-3p

Accession MIMAT0021670
Sequence

100 - 

guucaauaaagcugugggaag

 - 120

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).