Stem-loop sequence gma-MIR396h

AccessionMI0018679 (change log)
DescriptionGlycine max miR396h stem-loop
Gene family MIPF0000047; MIR396
Literature search

25 open access papers mention gma-MIR396h
(143 sentences)

Stem-loop
       --    u    c     c          u      acuguguugugugagguuucuccaagugaagguuu 
5' gaau  gguc uuuu gugau uuccacagcu ucuuga                                   a
   ||||  |||| |||| ||||| |||||||||| ||||||                                    
3' cuug  cuag agag cacua aaggugucga agaacu                                   a
       cu    u    u     a          u      uaacacgaguuucuuaaauacaacguauucccuag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 13772743-13772890 [+]
intergenic
Database links

Mature sequence gma-miR396h

Accession MIMAT0021668
Sequence

22 - 

uccacagcuuucuugaacug

 - 41

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2