Stem-loop sequence gma-MIR172j

AccessionMI0018671 (change log)
DescriptionGlycine max miR172j stem-loop
Gene family MIPF0000035; MIR172
Literature search

27 open access papers mention gma-MIR172j
(121 sentences)

Stem-loop
     a         g           a  -   ---- g     a   c 
5' gc ggugcagca caucaagauuc ca cac    a auucc ccu c
   || ||||||||| ||||||||||| || |||    | ||||| |||  
3' cg cuacgucgu guaguucuaag gu gug    u ugagg ggg u
     a         a           a  c   gauu g     -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 42009499-42009588 [-]
intergenic
Database links

Mature sequence gma-miR172j

Accession MIMAT0021660
Sequence

7 - 

gcagcagcaucaagauucaca

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).