Stem-loop sequence gma-MIR172i

AccessionMI0018670 (change log)
DescriptionGlycine max miR172i stem-loop
Gene family MIPF0000035; MIR172
Literature search

27 open access papers mention gma-MIR172i
(122 sentences)

Stem-loop
     a         g           a   cgc    uuugc        c gga      -a   uuaauuauacau       u 
5' gc ggugcagca caucaagauuc cac   cuaa     uaggacuu a   cugcac  cgc            acauaua a
   || ||||||||| ||||||||||| |||   ||||     |||||||| |   ||||||  |||            |||||||  
3' cg cuacgucgu guaguucuaag gug   gauu     aucuugaa u   ggcgug  gug            uguauau c
     a         a           g   -ua    ---uu        a -aa      ag   ---uuucucgau       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 2892841-2893001 [-]
intergenic
Database links

Mature sequence gma-miR172i-5p

Accession MIMAT0021659
Previous IDsgma-miR172i
Sequence

7 - 

gcagcagcaucaagauucaca

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR172i-3p

Accession MIMAT0022996
Sequence

137 - 

ggaaucuugaugaugcugcau

 - 157

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).