Stem-loop sequence gma-MIR172h

AccessionMI0018669 (change log)
DescriptionGlycine max miR172h stem-loop
Gene family MIPF0000035; MIR172
Literature search

27 open access papers mention gma-MIR172h
(123 sentences)

Stem-loop
     a         g           a  -   a  uu   - u  u 
5' gc ggugcagca caucaagauuc ca cac ga  uac c cc u
   || ||||||||| ||||||||||| || ||| ||  ||| | || g
3' cg cuacgucgu guaguucuaag gu gug cu  gug g gg g
     a         a           a  c   g  uu   u c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 44054389-44054479 [+]
intergenic
Database links

Mature sequence gma-miR172h-5p

Accession MIMAT0021657
Sequence

7 - 

gcagcagcaucaagauucaca

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR172h-3p

Accession MIMAT0021658
Sequence

67 - 

agaaucuugaugaugcugcau

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).