Stem-loop sequence gma-MIR172g

AccessionMI0018668 (change log)
DescriptionGlycine max miR172g stem-loop
Gene family MIPF0000035; MIR172
Literature search

27 open access papers mention gma-MIR172g
(121 sentences)

Stem-loop
     a         c           a  -ug   uuu  a -    --u          u 
5' gc ggugcagca caucaagauuc ca   caa   ac c ccua   aagagauuuu g
   || ||||||||| ||||||||||| ||   |||   || | ||||   ||||||||||  
3' cg cuacgucgu guaguucuaag gu   guu   ug g ggau   uucuuuaaaa a
     a         a           a  uca   --u  a a    ccu          c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 31996846-31996959 [-]
intergenic
Database links

Mature sequence gma-miR172g

Accession MIMAT0021656
Sequence

7 - 

gcagcaccaucaagauucac

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).