![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR171k |
|||||
Accession | MI0018667 (change log) | ||||
Description | Glycine max miR171k stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
15 open access papers mention gma-MIR171k | ||||
Stem-loop |
g c a c a - -ga a a 5' ga aaag gauguuggug gguucaauc ga ga cg uuuac ugu g || |||| |||||||||| ||||||||| || || || ||||| ||| 3' cu uuuc cuauaaccgc ccgaguuag cu cu gc aaaug acg a a a g a - a aua - a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR171k-5p |
|
Accession | MIMAT0021655 |
Previous IDs | gma-miR171k |
Sequence |
8 - cgauguuggugagguucaauc - 28 |
Evidence | experimental; Illumina [1] |
Mature sequence gma-miR171k-3p |
|
Accession | MIMAT0022995 |
Sequence |
73 - uugagccgcgccaauaucacu - 93 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|