Stem-loop sequence gma-MIR171k

AccessionMI0018667 (change log)
DescriptionGlycine max miR171k stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

15 open access papers mention gma-MIR171k
(40 sentences)

Stem-loop
     g    c          a         c  a  -  -ga     a   a 
5' ga aaag gauguuggug gguucaauc ga ga cg   uuuac ugu g
   || |||| |||||||||| ||||||||| || || ||   ||||| |||  
3' cu uuuc cuauaaccgc ccgaguuag cu cu gc   aaaug acg a
     a    a          g         a  -  a  aua     -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 27458231-27458328 [+]
intergenic
Database links

Mature sequence gma-miR171k-5p

Accession MIMAT0021655
Previous IDsgma-miR171k
Sequence

8 - 

cgauguuggugagguucaauc

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR171k-3p

Accession MIMAT0022995
Sequence

73 - 

uugagccgcgccaauaucacu

 - 93

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).