Stem-loop sequence gma-MIR169m

Accession MI0018665
Description Glycine max miR169m stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
            c         ug         agcaau   c     uaucuaucuauuu 
gaaaguagagug agccaagga  acuugccgg      aag aauaa             u
|||||||||||| |||||||||  |||||||||      ||| |||||             a
cuuuuguuuuac ucgguucuu  ugaacggcc      uuc uuauu             u
            a         gu         -gcacu   -     cuucuuuucuuuc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr13: 368441-368563 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR169m
gma-MIR169m chr13: 368441-368563 [-]
gma-MIR169o chr13: 363845-363943 [-]

Mature sequence gma-miR169m

Accession MIMAT0021653
Sequence

13 - 

cagccaaggaugacuugccgg

 - 33

Get sequence
Evidence experimental; Solexa [21663675]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).