|
miRBase |
|
Stem-loop sequence gma-MIR169l |
|||||
| Accession | MI0018664 | ||||
| Description | Glycine max miR169l stem-loop | ||||
| Gene family | MIPF0000037; MIR169_2 | ||||
| Stem-loop |
ugauu c ug g ugcauauauaugcauuagguacc gag ug agccaagaa acuugcc gaa a ||| || ||||||||| ||||||| ||| cuc ac ucgguuuuu ugaacgg cuu a uauuu a gu g uaauauguuauguugauauauac |
||||
| Genome context |
|
||||
Mature sequence gma-miR169l-5p |
|
| Accession | MIMAT0021652 |
| Previous IDs | gma-miR169l |
| Sequence |
11 - cagccaagaaugacuugccgg - 31 |
| Evidence | experimental; Solexa [1] |
Mature sequence gma-miR169l-3p |
|
| Accession | MIMAT0022994 |
| Sequence |
84 - cgggcaaguuguuuuuggcuac - 105 |
| Evidence | experimental; Solexa [2] |
References |
|
| 1 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
| 2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|