Stem-loop sequence gma-MIR169l

DescriptionGlycine max miR169l stem-loop
Gene family MIPF0000037; MIR169_2
      ugauu  c         ug       g   ugcauauauaugcauuagguacc 
5' gag     ug agccaagaa  acuugcc gaa                       a
   |||     || |||||||||  ||||||| |||                        
3' cuc     ac ucgguuuuu  ugaacgg cuu                       a
      uauuu  a         gu       g   uaauauguuauguugauauauac 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr14: 5324798-5324911 [+]

Mature sequence gma-miR169l-5p

Accession MIMAT0021652
Previous IDsgma-miR169l

11 - 


 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR169l-3p

Accession MIMAT0022994

84 - 


 - 105

Get sequence
Evidence experimental; Illumina [2]


PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).