Stem-loop sequence gma-MIR169k

AccessionMI0018663
DescriptionGlycine max miR169k stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
   u  uu  c         ug          augcuugcauuaggcauaa 
gag ga  ug agccaagaa  acuugccgga                   u
||| ||  || |||||||||  ||||||||||                   a
cuu uu  ac ucgguuuuu  ugaacggccu                   u
   u  uc  a         gu          aauauuucauauguugaua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr9: 5263992-5264096 [+]
intergenic

Mature sequence gma-miR169k

Accession MIMAT0021651
Sequence

11 - 

cagccaagaaugacuugccgg

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).