Stem-loop sequence gma-MIR169j

AccessionMI0018662 (change log)
DescriptionGlycine max miR169j stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

23 open access papers mention gma-MIR169j
(96 sentences)

Stem-loop
              ug     c      g      -uu    agg 
5' guagccaagaa  acuug cggaau caugca   uauu   u
   |||||||||||  ||||| |||||| ||||||   ||||   a
3' caucgguucuu  ugagc gcuuua guaugu   gugg   c
              gu     a      -      uau    aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 43801693-43801777 [-]
intergenic
Database links

Mature sequence gma-miR169j-5p

Accession MIMAT0021649
Sequence

2 - 

uagccaagaaugacuugccgg

 - 22

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence gma-miR169j-3p

Accession MIMAT0021650
Sequence

62 - 

uuucgacgaguuguucuuggc

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).