Stem-loop sequence gma-MIR166j

AccessionMI0018661 (change log)
DescriptionGlycine max miR166j stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166j
(213 sentences)

Stem-loop
       g         uu      cu     uaacuaugcau        uuuu     -             ----aa    u   uu    u 
5' gguu augggaaug  guuugg  cgagg           ggucuuaa    guuca ucuuugaagcuuu      uuua ggg  ucga c
   |||| |||||||||  ||||||  |||||           ||||||||    ||||| |||||||||||||      |||| |||  |||| u
3' ccaa ugcccuuac  cggacc  gcucu           ucggaguu    uaggu ggaaauuucgaaa      aagu ccc  aguu c
       a         uu      ag     ----------u        ---u     u             gaaaca    u   -u    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 3706979-3707146 [-]
intergenic
Database links

Mature sequence gma-miR166j-5p

Accession MIMAT0021647
Sequence

9 - 

ggaauguuguuuggcucgagg

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR166j-3p

Accession MIMAT0021648
Sequence

142 - 

ucggaccaggcuucauucccg

 - 162

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).