Stem-loop sequence gma-MIR166i

AccessionMI0018660 (change log)
DescriptionGlycine max miR166i stem-loop
Gene family MIPF0000004; MIR166
Literature search

38 open access papers mention gma-MIR166i
(213 sentences)

Stem-loop
                uc             c      u c   u    uca 
5' guugaggggaaug  gucugguucgaga cauuca g aag aguc   g
   |||||||||||||  ||||||||||||| |||||| | ||| ||||    
3' cgacuccccuuac  cggaccaggcuuu gugagu c uuc ucag   a
                uu             a      - -   -    uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 14544488-14544584 [+]
intergenic
Database links

Mature sequence gma-miR166i-5p

Accession MIMAT0021645
Sequence

8 - 

ggaaugucgucugguucgag

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR166i-3p

Accession MIMAT0021646
Sequence

72 - 

ucggaccaggcuucauucccc

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).