Stem-loop sequence gma-MIR162c

AccessionMI0018659 (change log)
DescriptionGlycine max miR162c stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

10 open access papers mention gma-MIR162c
(16 sentences)

Stem-loop
   gagau    ug    --- a     g    c    c       uc   c  aauuugg     ga 
5'      gagg  aagu   c cugga gcag gguu aucgauc  uuc ug       uugug  a
        ||||  ||||   | ||||| |||| |||| |||||||  ||| ||       |||||   
3'      cucc  uuca   g gaccu cguc ccaa uagcugg  aag ac       aacac  g
   -----    gu    cuc c     a    u    a       cu   a  -----ga     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 9894786-9894904 [+]
intergenic
Database links

Mature sequence gma-miR162c

Accession MIMAT0021644
Sequence

84 - 

ucgauaaaccucugcauccag

 - 104

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).