Stem-loop sequence gma-MIR159f

AccessionMI0018658 (change log)
DescriptionGlycine max miR159f stem-loop
Gene family MIPF0000010; MIR159
Literature search

23 open access papers mention gma-MIR159f
(78 sentences)

Stem-loop
       aag            g        gu ug     a  ugau       c  ug  g    u     g u   uc    c   u   aa 
5' accc   uuggaguucccu cacuccaa  c  aaagg ua    gguaaac uc  cu cuag ucaug a acc  uggc ucg aac  c
   ||||   |||||||||||| ||||||||  |  ||||| ||    ||||||| ||  || |||| ||||| | |||  |||| ||| |||  a
3' uggg   gaccucgaggga gugagguu  g  uuucc gu    ccauuug ag  ga gguc aguac u ugg  acug agc uug  u
       --a            a        au gu     a  ---u       -  ua  g    c     g u   ga    a   -   cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 2819636-2819815 [-]
intergenic
Database links

Mature sequence gma-miR159f-5p

Accession MIMAT0021642
Sequence

11 - 

gaguucccugcacuccaaguc

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR159f-3p

Accession MIMAT0021643
Sequence

154 - 

auuggagugaagggagcucca

 - 174

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).