Stem-loop sequence gma-MIR159e

AccessionMI0018657 (change log)
DescriptionGlycine max miR159e stem-loop
Gene family MIPF0000010; MIR159
Literature search

23 open access papers mention gma-MIR159e
(91 sentences)

Stem-loop
   -         -uuau  a            ga       uu      cu    ----   ug   u     g     c      uc      uu     -  ucauua 
5'  caaaggggg     gg guggagcuccuu  aguccaa  gaggau  uacu    ggg  gau gagcu cuuag uaugga  ccacag  cuacc ca      a
    |||||||||     || ||||||||||||  |||||||  ||||||  ||||    |||  ||| ||||| ||||| ||||||  ||||||  ||||| ||       
3'  guuuucccc     cc caucucgaggga  uuagguu  uuccua  auga    ucc  uua uucga ggguc auaccu  gguguu  gaugg gu      g
   u         ucuuc  a            ag       uc      uu    uauu   gu   c     g     u      uc      cu     u  uuucgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 9561934-9562144 [-]
intergenic
Database links

Mature sequence gma-miR159e-5p

Accession MIMAT0021640
Sequence

20 - 

gagcuccuugaaguccaauu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR159e-3p

Accession MIMAT0021641
Sequence

172 - 

uuuggauugaagggagcucua

 - 192

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).