Stem-loop sequence gma-MIR156n

AccessionMI0018655 (change log)
DescriptionGlycine max miR156n stem-loop
Gene family MIPF0000008; MIR156
Literature search

40 open access papers mention gma-MIR156n
(162 sentences)

Stem-loop
               -   -a         a       cu       a 
5' aaauugacagaa gag  gugagcaca agaggca  ugauaua u
   |||||||||||| |||  ||||||||| |||||||  |||||||  
3' uuuggcugucuu cuc  cacucgugu uuuucgu  acuauau u
               u   ac         g       -c       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 10456738-10456826 [-]
intergenic
Database links

Mature sequence gma-miR156n

Accession MIMAT0021638
Sequence

4 - 

uugacagaagagagugagcac

 - 24

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2