Stem-loop sequence gma-MIR156m

AccessionMI0018654
DescriptionGlycine max miR156m stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -   -  u u         -a             -u     u     uaaaaauaugg 
5'  agg gu g ugacagaag  uagagagcacaga  aguga augca           a
    ||| || | |||||||||  |||||||||||||  ||||| |||||           a
3'  ucc ca c acugucuuc  aucucucguguuu  ucacu uacgu           c
   u   a  c u         gg             cc     c     uaacgaaaggg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr9: 37843750-37843864 [-]
intergenic

Mature sequence gma-miR156m

Accession MIMAT0021637
Sequence

8 - 

uugacagaagauagagagcac

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).