Stem-loop sequence gma-MIR156m

AccessionMI0018654 (change log)
DescriptionGlycine max miR156m stem-loop
Gene family MIPF0000008; MIR156
Literature search

40 open access papers mention gma-MIR156m
(162 sentences)

Stem-loop
   -   -  u u         -a             -u     u     uaaaaauaugg 
5'  agg gu g ugacagaag  uagagagcacaga  aguga augca           a
    ||| || | |||||||||  |||||||||||||  ||||| |||||           a
3'  ucc ca c acugucuuc  aucucucguguuu  ucacu uacgu           c
   u   a  c u         gg             cc     c     uaacgaaaggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 40437756-40437870 [-]
intergenic
Database links

Mature sequence gma-miR156m

Accession MIMAT0021637
Sequence

8 - 

uugacagaagauagagagcac

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).