Stem-loop sequence gma-MIR156l

AccessionMI0018653 (change log)
DescriptionGlycine max miR156l stem-loop
Gene family MIPF0000008; MIR156
Literature search

40 open access papers mention gma-MIR156l
(162 sentences)

Stem-loop
     ua    u u         -a             u  -   u     cauauacauggaa 
5' gg  aggu g ugacagaag  uagagagcacaga ga uga augca             c
   ||  |||| | |||||||||  ||||||||||||| || ||| |||||             a
3' cc  ucca c acugucuuc  aucucucguguuu cu acu uacgu             g
     --    c u         ga             c  c   c     uaacgaauuuaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 9384146-9384266 [+]
intergenic
Database links

Mature sequence gma-miR156l

Accession MIMAT0021636
Sequence

11 - 

uugacagaagauagagagcac

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).