Stem-loop sequence gma-MIR156k

AccessionMI0018652 (change log)
DescriptionGlycine max miR156k stem-loop
Gene family MIPF0000008; MIR156
Literature search

40 open access papers mention gma-MIR156k
(162 sentences)

Stem-loop
      a         -    -        a        cu       g 
5' gaa uugacagaa gaga gugagcac cagaggca  ugguaua u
   ||| ||||||||| |||| |||||||| ||||||||  ||||||| a
3' cuu aacugucuu cucu cacucgug guuuucgu  aucauau u
      c         u    u        c        -u       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 4705086-4705177 [-]
intergenic
Database links

Mature sequence gma-miR156k

Accession MIMAT0021635
Sequence

5 - 

uugacagaagagagugagcac

 - 25

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2