Stem-loop sequence gma-MIR156j

AccessionMI0018651 (change log)
DescriptionGlycine max miR156j stem-loop
Gene family MIPF0000008; MIR156
Literature search

40 open access papers mention gma-MIR156j
(164 sentences)

Stem-loop
   g      cugu     -      -            u  -   a    aagaa 
5'  gugaug    ugaca gaagau agagagcacaga ga uga augc     a
    ||||||    ||||| |||||| |||||||||||| || ||| ||||     g
3'  uacuac    acugu cuucug ucucucguguuu cu auu uacg     g
   u      ---u     u      a            u  c   c    guaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 7901956-7902058 [+]
intergenic
Database links

Mature sequence gma-miR156j

Accession MIMAT0021634
Sequence

11 - 

uugacagaagauagagagcac

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).