Stem-loop sequence gma-MIR395c

AccessionMI0018644 (change log)
DescriptionGlycine max miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

15 open access papers mention gma-MIR395c
(70 sentences)

Stem-loop
     ua          u         u  a     cu   u  gu 
5' cc  gaguuccccu aaugcuuca ug ggauu  guu ag  c
   ||  |||||||||| ||||||||| || |||||  ||| ||   
3' gg  cucaaggggg uugugaagu au ccuga  caa uu  c
     gc          u         c  c     -u   u  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 41475132-41475218 [+]
intergenic
Database links

Mature sequence gma-miR395c

Accession MIMAT0021626
Sequence

63 - 

cugaaguguuugggggaacuc

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).