Stem-loop sequence gma-MIR395c

Accession

MI0018644

Description

Glycine max miR395c stem-loop

Gene family

MIPF0000016; MIR395

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-395_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-395 is a non-coding RNA called a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-395 is thought to target mRNAs coding for ATP sulphurylases. The mature sequence is excised from the 3' arm of the hairpin. miR-395 is upregulated in Arabidopsis during sulphate-limited conditions, when the mature miRNA then regulates sulphur transporters and ATP sulphurylases.

Stem-loop

  ua          u         u  a     cu   u  gu 
cc  gaguuccccu aaugcuuca ug ggauu  guu ag  c
||  |||||||||| ||||||||| || |||||  ||| ||   
gg  cucaaggggg uugugaagu au ccuga  caa uu  c
  gc          u         c  c     -u   u  aa 

Genome context

• Coordinates (Phytozome5.0): Gm08: 40840226-40840312 [+]
• Overlapping transcripts:

  intergenic

Mature sequence gma-miR395c

• Accession: MIMAT0021626
• Sequence: 63 - cugaaguguuugggggaacuc - 83
• Evidence: experimental; Solexa [1]

References

1. PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).