Stem-loop sequence gma-MIR395b

AccessionMI0018643 (change log)
DescriptionGlycine max miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

16 open access papers mention gma-MIR395b
(71 sentences)

Stem-loop
     -  ua         ug         u  aa     -uua   aaau 
5' uc cc  gaguuuccc  aacacuuca ua  gggcu    uug    a
   || ||  |||||||||  ||||||||| ||  |||||    |||     
3' ag gg  cucaagggg  uugugaagu au  ucuga    aac    u
     u  uc         gu         c  -a     uuga   cuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 1747330-1747424 [-]
intergenic
Database links

Mature sequence gma-miR395b

Accession MIMAT0021625
Sequence

68 - 

cugaaguguuugggggaacuc

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).