Stem-loop sequence gma-MIR395a

AccessionMI0018642 (change log)
DescriptionGlycine max miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

15 open access papers mention gma-MIR395a
(72 sentences)

Stem-loop
         u uc  ua         ug        auuaaagggcuuuauuaucau 
5' ucaggu u  cc  gaguucccc  aacgcuuc                     a
   |||||| |  ||  |||||||||  ||||||||                      
3' aguuca a  gg  cucaagggg  uugugaag                     u
         u gu  cc         gu        ucauaccugauugaacccuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 4840520-4840629 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR395a
gma-MIR395jchr1: 4832871-4832996 [-]
gma-MIR395kchr1: 4835314-4835439 [-]
gma-MIR395achr1: 4840520-4840629 [+]
Database links

Mature sequence gma-miR395a

Accession MIMAT0021624
Sequence

76 - 

cugaaguguuugggggaacuc

 - 96

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).