Stem-loop sequence asu-mir-5367

AccessionMI0018620 (change log)
DescriptionAscaris suum miR-5367 stem-loop
Stem-loop
   aag  - a    -  c  c   ucu         uu aa 
5'    gc c aagc gg cu aga   ugccaauuu  c  u
      || | |||| || || |||   |||||||||  |   
3'    cg g uucg cc ga ucu   acgguuaaa  g  g
   --g  a g    g  a  u   -cc         uu gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-5367-5p

Accession MIMAT0021600
Previous IDsasu-miR-5367*
Sequence

10 - 

gcggccucagaucuugccaauuu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-5367-3p

Accession MIMAT0021601
Previous IDsasu-miR-5367
Sequence

47 - 

auuggcaccucuuagaccggcu

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).