Stem-loop sequence asu-mir-44b

AccessionMI0018602 (change log)
DescriptionAscaris suum miR-44b stem-loop
Stem-loop
   -    a             -    a        acg  u 
5'  agua gcuacuggaugug uguc uagucaug   ug g
    |||| ||||||||||||| |||| ||||||||   ||  
3'  uuau uggugacuuacac auag aucaguac   ac a
   u    a             u    -        --a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-44b-5p

Accession MIMAT0021564
Previous IDsasu-miR-44b
Sequence

9 - 

acuggaugugugucauagucaug

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-44b-3p

Accession MIMAT0021565
Previous IDsasu-miR-44b*
Sequence

46 - 

ugacuagauaucacauucagugg

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).