Stem-loop sequence asu-mir-5350d

AccessionMI0018599 (change log)
DescriptionAscaris suum miR-5350d stem-loop
Stem-loop
   ---cg  ----   c    u     aa      --    uu 
5'      gc    ggc uuuc cgggu  gcuaaa  uugu  u
        ||    ||| |||| |||||  ||||||  ||||   
3'      cg    ccg aagg gcccg  cgguuu  agcg  u
   uauga  uuac   u    u     ca      aa    ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-5350d-5p

Accession MIMAT0021558
Previous IDsasu-miR-5350d*
Sequence

7 - 

ccuuucucggguaagcuaaauu

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-5350d-3p

Accession MIMAT0021559
Previous IDsasu-miR-5350d
Sequence

43 - 

uuuggcacgcccguggaaugcc

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).