Stem-loop sequence asu-mir-5350a

AccessionMI0018596 (change log)
DescriptionAscaris suum miR-5350a stem-loop
Stem-loop
     -  c    g     c     ac         -  ga 
5' cc gc ggag aguuu ucagg  ugcuaaauu gu  a
   || || |||| ||||| |||||  ||||||||| ||   
3' gg ug ucuc ucaaa agucc  acgguuuaa cg  u
     a  u    a     a     gc         u  gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-5350a-5p

Accession MIMAT0021552
Previous IDsasu-miR-5350a*
Sequence

11 - 

aguuucucaggacugcuaaauu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-5350a-3p

Accession MIMAT0021553
Previous IDsasu-miR-5350a
Sequence

46 - 

uuuggcacgccugaaaaacuac

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).