Stem-loop sequence asu-mir-5347

AccessionMI0018592 (change log)
DescriptionAscaris suum miR-5347 stem-loop
Stem-loop
   c    cu              c        ---      acc 
5'  ucug  uacauucggcuucc ucaacgcc   gcugcu   a
    ||||  |||||||||||||| ||||||||   ||||||   g
3'  agac  augugagcuggagg aguugugg   cgacga   c
   -    ag              c        cag      cac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-5347-5p

Accession MIMAT0021544
Previous IDsasu-miR-5347*
Sequence

14 - 

cggcuucccucaacgccgcugc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-5347-3p

Accession MIMAT0021545
Previous IDsasu-miR-5347
Sequence

51 - 

cgacgguguugacggaggucgag

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).