Stem-loop sequence asu-mir-1175

AccessionMI0018586 (change log)
DescriptionAscaris suum miR-1175 stem-loop
Gene family MIPF0000715; mir-1175
Stem-loop
   gac   caaa           u    --   g    ga   ac 
5'    ggu    aaaguggagga uggg  ucu cacu  aug  a
      |||    ||||||||||| ||||  ||| ||||  |||   
3'    ccg    uuuuaccuccu acuc  aga guga  uac  u
   --u   ucga           u    uu   -    --   gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-1175-5p

Accession MIMAT0021533
Previous IDsasu-miR-1175
Sequence

12 - 

aaguggaggauugggucugcacu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-1175-3p

Accession MIMAT0021534
Previous IDsasu-miR-1175*
Sequence

51 - 

ugagauucucauuccuccauuu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).