Stem-loop sequence asu-mir-993

AccessionMI0018585 (change log)
DescriptionAscaris suum miR-993 stem-loop
Stem-loop
   -c   u     ac        ag  u      cugcac 
5'   gga gguuu  ccuguaga  cg guuuau      a
     ||| |||||  ||||||||  || ||||||       
3'   ccu ccagg  ggacaucu  gc cgaaua      u
   ga   u     ac        cu  u      aaacuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-993-5p

Accession MIMAT0021531
Previous IDsasu-miR-993*
Sequence

11 - 

acccuguagaagcguguuuauc

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-993-3p

Accession MIMAT0021532
Previous IDsasu-miR-993
Sequence

47 - 

uaagcucgucucuacaggcagg

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).