Stem-loop sequence asu-mir-239

AccessionMI0018580 (change log)
Previous IDsasu-mir-5344
DescriptionAscaris suum miR-239 stem-loop
Gene family MIPF0000135; mir-239
Stem-loop
   ----     g a u        c             cu ua 
5'     uuguu a c uuguacuu ggcuaaggugcug  c  u
       ||||| | | |||||||| |||||||||||||  |   
3'     gauaa u g aacgugga ucgguuccaugac  g  g
   gguu     g c c        -             cg cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-239-5p

Accession MIMAT0021521
Previous IDsasu-miR-5344
Sequence

10 - 

uuuguacuucggcuaaggugcug

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-239-3p

Accession MIMAT0021522
Previous IDsasu-miR-5344*
Sequence

48 - 

uaccuuggcuaggugcaacgc

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).