Stem-loop sequence asu-mir-279c

AccessionMI0018577 (change log)
DescriptionAscaris suum miR-279c stem-loop
Gene family MIPF0000184; mir-279
Literature search

1 open access papers mention asu-mir-279c
(4 sentences)

Stem-loop
   uuacu     uc        u  c     -       g    uaau 
5'      gggcg  acuggagc gg uuacc gucuagu caug    g
        |||||  |||||||| || ||||| ||||||| ||||    u
3'      cuugc  ugaucucg cc aaugg cagauca guac    g
   --uuc     uu        u  -     u       -    uaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-279c-5p

Accession MIMAT0021515
Previous IDsasu-miR-279c*
Sequence

19 - 

gcuggcuuaccgucuagugcau

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-279c-3p

Accession MIMAT0021516
Previous IDsasu-miR-279c
Sequence

55 - 

ugacuagacugguaaccugcuc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).